FASTA exemple

Above an exemple of FASTA file of mRNA of Homo sapiens extracted from Reference Sequence (Ref-Seq) database :

>NM_020790.1 Homo sapiens mucin 20, cell surface associated (MUC20), transcript variant 4, mRNA
ACATTTGTGATCACCTGGTCACACACCTGGGCAGGAGGCTGCCCCTCCCTGGTTTGAGGAAGCAGGAAAA
GGTACCCGCGAGAGACAGCCAGCAGTTCTGTGGAGCAGCGGTGGCCGGCTAGGATGGGCTGTCTCTGGGG
TCTGGCTCTGCCCCTTTTCTTCTTCTGCTGGGAGGTTGGGGTCTCTGGGAGCTCTGCAGGCCCCAGCACC
CGCAGAGCAGACACTGCGATGACAACGGACGACACAGAAGTGCCCGCTATGACTCTAGCACCGGGCCACG
CCGCTCTGGAAACTCAAACACTGAGCGCTGAGACCTCTTCTAGGGCCTCAACCCCAGCCGGCCCCGTTCC
AGAAGCAGAGACCAGGGGATCCAAGAGAATTTCCCCTGCAAGAGAGACCAGGAGTTTCACAAAAACATCT
CCCAACTTCATGGTGCTGATCGCCACCTCCGTGGAGACATCAGCCGCCAGTGGCAGCCCCGAGGGAGCTG
GAATGACCACAGTTCAGACCATCACAGGCAGTGATCCCGAGGAAGCCATCTTTGACACCCTTTGCACCGA
TGACAGCTCTGAAGAGGCAAAGACACTCACAATGGACATATTGACATTGGCTCACACCTCCACAGAAGCT
AAGGGCCTGTCCTCAGAGAGCAGTGCCTCTTCCGACGGCCCCCATCCAGTCATCACCCCGTCACGGGCCT
CAGAGAGCAGCGCCTCTTCCGACGGCCCCCATCCAGTCATCACCCCGTCACGGGCCTCAGAGAGCAGCGC
CTCTTCCGACGGCCCCCATCCAGTCATCACCCCGTCACGGGCCTCAGAGAGCAGCGCCTCTTCCGACGGC
CCCCATCCAGTCATCACCCCCTCATGGTCCCCGGGATCTGACGTCACTCTCCTCGCTGAAGCCCTGGTGA
CTGTCACAAACATCGAGGTTATTAATTGCAGCATCACAGAAATAGAAACAACGACTTCCAGCATCCCTGG
GGCCTCAGACACAGATCCCATCCCCACGGAAGGGGTGAAGGCCTCGTCCACCTCCGATCCACCAGCTCTG
CCTGACTCCACTGAAGCAAAACCACACATCACTGAGGTCACAGCCTCTGCCGAGACCCTGTCCACAGCCG
GCACCACAGAGTCAGCTGCACCTGATGCCACGATTGGGACCCCACTCCCCACCAACAGCACCATAGAAAG
AGAAGTGACAGCACCCGGGGCCACGACCCTCAGTGGAGCTCTGGCCACAGGGAATCCCCTGGAAGAAACC
TCAGCCCTCTCTGTTGAGACACCAAGTTACGTCAAAGTCTCAGGAGCAGCTCCGGTCTCCATAGAGGCTG
GGTCAGCAGTGGGCAAAACAACTTCCTTTGCTGGGAGCTCTGCTTCCTCCTACAGCCCCTCGGAAGCCGC
CCTCAAGAACTTCACCCCTTCAGAGACACTGACCACGGACATCGCAACCAAGGGGCCCTTCCCCACCAGC
AGGGACCCTCTTCCTTCTGTCCCTCCAACTACAACCAACAGCAGCCGAGGGACGAACAGCACCTTAGCCA
AGATCACAACCTCAGCGAAGACCACGATGAAGCCCCCAACAGCCACGCCCACGACTGCCCGGACGAGGCC
GACCACAGACATGAGTGCAGGTGAAAATGGAGGTTTCCTCCTCCTGCGGCTGAGTGTGGCTTCCCCGGAA
GACCTCACTGACCCCAGAGTGGCAGAAAGGCTGATGCAGCAGCTCCACCGGGAACTCCACGCCCACGCGC
CTCACTTCCAGGTCTCCTTACTGCGTGTCAGGAGAGGCTAACGGACATCAGCTGCAGCCAGGCATGTCCC
GTATGCCAAAAGAGGGTGCTGCCCCTAGCCTGGGCCCCCACCGACAGACTGCAGCTGCGTTACTGTGCTG
AGAGGTACCCAGAAGGTTCCCATGAAGGGCAGCATGTCCAAGCCCCTGACCCCAGATGTGGCAACAGGAC
CCTCGCTCACATCCACCGGAGTGTATGTGTGGGGAGGGGCTTCACCTGTTCCCAGAGGTGTCCTTGGACT
CACCTTGGCACATGTTCTGTGTTTCAGTAAAGAGAGACCTGATCACCCATCTGTGTGCTTCCATCCTGCA
TTAAAATTCACTCAGTGTGGCCCAGAAAAAAAAAAAAAAAAAAAAA

Detailed description of the FASTA format is available at NCBI.

Please send comments and questions to Pinto, Cristiano

© 2016 transduTIS. All Rights Reserved Privacy - Terms of Use